This allele from project TCPR0788 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four guide RNAs having spacer sequences of GAGAGCTGTGCTTAAACTCG and ACGTGCCAAAACTGCCCTGT targeting the 5' side and CACTGGGCAATCATGACTAC and TGTCAGAGTTATGACAGTGG targeting the 3' side of exons ENSMUSE00000098735, ENSMUSE00000724134, and ENSMUSE00001304146 resulting in a 1647-bp deletion of Chr10 from 57800909 to 57802555 and a 2-bp deletion of Chr10: 57802634 to 57802635 (GRCm38). (J:200814)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count