This allele from project TCPR0556 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AAGAAATAAGTTGCCCTCAT and ATACCTGATTGGATCAAGAT targeting the 5' side and CCAGTTGGTAGTATCCTTAG and CTTGCTCCCACTCTGAAGTG targeting the 3' side of exons ENSMUSE00000558006, ENSMUSE00000558005, and ENSMUSE00000558003 resulting in a 5734-bp deletion of Chr14 from 61179235 to 61184968 (GRCm38). (J:200814)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count