This allele, from project TCPR0402, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences ATGTCCGTTTGGCAGAATAG, ATTAAGATAGAACGCATACC, TTGCACCTCTGGGATAATGT, and GCCTGGGTATGTGATCTATT. This resulted in a 777-bp del Chr12:26327093 to 26327869; p.(C46Rfs*23) (GRCm38). (J:200814)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count