This allele from project TCPR0523 was generated at The Centre for Phenogenomics by injecting Cas9 ribnucleoprotein complex with synthetic crRNAs with a spacer sequences of UGCCUCAGCAAGAUUUAAAC targeting the 5' side and GGUUCAAGCUAUGGAUUCUG targeting the 3' side of exon ENSMUSE00000269846 resulting in a 847-bp deletion of Chr17 from 10282533 to 10283379 (GRCm38). (J:200814)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count