This allele from project TCPR0379 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences of ATGCTACGTGTTATGTTGGG targeting the 5' side and AGTCCTGTCCTGCATGCAGG targeting the 3' side of OTTMUSE00000245667 and OTTMUSE00000245014. Two single-strand oligonucleotides were also injected to introduce loxP sites. Subsequent NHEJ-mediated repair resulted in c.106_329del. This mutation is predicted to cause a frameshift with the amino acid changes after residue 36 and early truncation 7 amino acids later (p.E36S*fs9). (J:200814)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count