This allele produced from project TCPR0322 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences ATAGGTGACTTAGCCTGACG and AGCCTCACCAACACGGGCAA resulting in a deletion of 666-bp from Chr5 from 114452050 to 114452715 witgh an insertion of a single T at the junction (GRCm38). (J:200814)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count