This allele from project TCPR0506 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CCATTCGAGAGGTAAGGATG and ACAGTAGGCTTGCCTTGGGC targeting the 5' side and GGGACAGACGTTAAGTAAAA and TTGCTTCAGGTTAGCTCAGC targeting the 3' side of the target region resulting in an 804-bp deletion of Chr13 from 112996485 to 112997288 (GRCm38). (J:200814)