This allele from project TCPR443 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of ATAGTTCAGTACAGTTCACT and GTATGTTTCATCTAGCCACC targeting the 5' side and GAATTAGCTGAGAGCTAGGT and TCCAAGCCTGGCTCCGATCA targeting the 3' side of a critical exon resulting in a 398-bp deletion on Chr6 from 125046790 to 125047187 (GRCm38). (J:200814)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count