This allele from project TCPR0251 was generated at The Centre for Phenogenomics by injecting Cas9 endonuclease and a guide RNA with the spacer sequence GCAGGTTAACTCCACCTCGG resulting in a 17-bp deletion from Chr8:25971594 to 25971578 (GRCm38). (J:200814)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count