Hdgfl1^em2(IMPC)Tcp

This allele from project TCPR0433 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GTTCGATCCTCGCTGGCCAG and CGCTACCAGGTGTTCTTCTT targeting the 5' side and GCGGTCCAGGGCCTGATTGT and TCTACAAACACCGTGACTAC targeting the 3' side of exon ENSMUSE00000509603 resulting in a 726-bp deletion in Chr13 from 26769238 to 26769963 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 42 and early truncation 4 amino acids later (p.F42Lfs*6). (J:200814)