Gpr141b^em3(IMPC)Tcp

This allele from project TCPR0383 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences of CACTTGAGCCATTTGACACG, GTTACAAAAGTTCCATGCCG, and TTATACCCCACCATGCATTC resulting in a 738 bp deletion of Chr13 from 19729115 to 19729852 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 10 and early truncation 40 amino acids later (p.S10Ffs*42). (J:200814)