Gpr141b^em2(IMPC)Tcp

This allele from project TCPR0383 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences of CACTTGAGCCATTTGACACG, GTTACAAAAGTTCCATGCCG and TTATACCCCACCATGCATTC resulting in a 744 bp deletion of Chr13 from 19729111 to 19729854 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 10 and early truncation 39 amino acids later (p.S10Vfs*41). (J:200814)