This allele from project TCPR0417 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GTGAGCTCGGTCTTGGTTTG and CTTCAGGACGGTGTACTGCC targeting the 5' side and CAGCTCAGTGTCCTAATCAC and ATGTCCGTTTGGCAGAATAG targeting the 3' side of exon ENSMUSE00000403934 resulting in a 1,705-bp deletion of Chr10 from 18783188 to 18784892 deleting majority of ENSMUSE00000403934 including splice donor (single exon ORF) and a 2-bp deletion Chr10 from 18783160 to 18783161 (GRCm38). (J:200814)