This allele from project TCPR0802 was generated at The Centre for Phenogenomics by electroporating Cas9 RNP complexes with four guide RNAs with spacer sequences of TCTATTTACCCTCGTACCCA and GTACAGGATGCTAGACTATA targeting the 5' side and AGTGTAATAGGCTCCAAGAG and ACTCACTGAAAACAGTCCGG targeting the 3' side of exon ENSMUSE00000312307 resulting in a 703-bp deletion of Chr12 from 51356753 to 51357455 (GRCm38). (J:200814)