This allele from project TCPR907 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of GCCAACCTCTGTTGCGGCAT and GTCCATCGAGAAGGCACCCT targeting the 5' side and GATTGCGAGTACCGCCTACC and GGCAACGAGCGTGTCAAGGA targeting the 3' side leading to the a 1,272-bp deletion from Chr7:105388318 to 105389589 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (J:200814)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count