This allele from project TCPR0801 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four guide RNAs with spacer sequences of GCTTGTATGCTACTTTTCAA and CTGTTTGAAGACCCCTTGGC targeting the 5' side and ACAGCTTTCGATTGATAGAA and GTGGACTTTCACACCTGACT targeting the 3' side of exon ENSMUSE00001282667 (exon 3) resulting in a 872-bp deletion of Chr6 from 134758324 to 134759195_insG (GRCm38). (J:200814)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count