This allele, from project TCPR0366, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences AAGCCGAGTCCACAATGCGC and TGCGCAAGGCAACTATCCTA. This resulted in a 48 bp deletion from Chr2:118761689 to 118761736 (GRCm38), and an insertion of GCTCGGCATCTTTTTCCTC. This mutation is predicted to cause a frameshift with amino acid changes after residue 56 and early truncation 57 amino acids later (p.T57Sfs*59). (J:200814)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count