Zgrf1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTATACCATTCTGTATAGGC and ACGAATACAGACCAGAATGG, which resulted in a 392 bp deletion beginning at Chromosome 3 position 127,567,439 bp and ending after 127,567,830 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000563295 (exon 7) and 318 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 698 and early truncation 1 amino acids later. (J:188991)