Naa35^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATAATTGAAAGCATCACTG and TAGGATACTTTTCACGAAGA, which resulted in a 306 bp deletion beginning at Chromosome 13 position 59,595,218 bp and ending after 59,595,523 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000118943 (exon 3) and 272 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 12 amino acids later. There is a 3 bp intronic deletion (TCT) 41 bp before the larger deletion site. (J:188991)