Klhl4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGTTGACTAACAATACGTA and CATTAGTTAATATACATTGG, which resulted in a 173 bp deletion beginning at Chromosome X position 114,522,276 bp and ending after 114,522,448 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000295916 (exon 3) and 36 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 196 and early truncation 9 amino acids later. (J:188991)