Zc3h7b^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGTCTGCTCAGTTAGTCAG and TCCAACCCCCTACCCTAGCC, which resulted in a 289 bp deletion beginning at Chromosome 15 position 81,768,613 bp and ending after 81,768,901 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000253367 (exon 3) and 255 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 18 and early truncation 33 amino acids later. (J:188991)