Hps5^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAGTCGTCACCTCTCCCTG and TTACATTGTGTCCCGGGCAG, which resulted in a 690 bp deletion beginning at Chromosome 7 position 46,788,692 bp and ending after 46,789,381 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001284002, ENSMUSE00001285409 (exons 3 and 4) and 514 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 36 and early truncation 46 amino acids later. (J:188991)