This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAAACAATAGGAAGCTCCCA and GAGGTGTGTAAGGTGATCCA, which resulted in a 348 bp deletion beginning at Chromosome 8 position 111,841,722 bp and ending after 111,842,069 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000214932 (exon 3) and 140 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation at amino acid 61. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count