Avl9^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGACCCTTTAAATCAGCT and TCTGGGCAGGAGGGAGCCGA, which resulted in a 786 bp deletion beginning at Chromosome 6 position 56,723,008 bp and ending after 56,723,793 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001208835 (exon 2) and 665 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation 31 amino acids later. There is a single bp (T) insertion at the deletion site. (J:188991)