Nsmce4a^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTGGTCTTAGAGTGTTCTA and TGAGCTCTAAGACTGGTGAG, which resulted in a 469 bp deletion beginning at Chromosome 7 position 130,542,540 bp and ending after 130,543,008 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001241414 (exon 3) and 338 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 120 and early truncation 16 amino acids later. There is an 8 bp insertion at the del site (AGCTAGAG). (J:188991)