Eif4b^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTATAGTAGTGACTGGTCTG and GTCTTTTTGTGTCAAACTGT, which resulted in a 414 bp deletion beginning at Chromosome 15 position 102,083,956 bp and ending after 102,084,369 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000454881 (exon 3) and 205 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 24 amino acids later. There is a single bp (G) insertion 13 bp after the deletion. (J:188991)