Pcnx4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTATTTACCAAGATAAACTG and CCACAGTTACACTCAGCCAC, which resulted in a 198 bp deletion beginning at Chromosome 12 position 72,556,521 bp and ending after 72,556,718 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000437603 (exon 5) and 97 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 464 and early truncation 32 amino acids later. (J:188991)