This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTTCCTTAAGACTTCATTA and AGATTCACTATTAGATACAT, which resulted in a 1055 bp deletion beginning at Chromosome 4 position 108,265,749 bp and ending after 108,266,803 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000601600 (exon 3) and 300 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 22 amino acids later. There is a single bp insertion (G) at the deletion site. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count