Zfp512b^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTGGCACAGGATATATGGA and ATATCACCGACCCCCAAGGG, which resulted in a 295 bp deletion beginning at Chromosome 2 position 181,590,391 bp and ending after 181,590,685 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000170907 (exon 3) and 152 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 9 amino acids later. There is an 11 bp insertion (CCAGCCCTCAC) at the deletion site. (J:188991)