This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTTTGTGATACGTACTCAA and TGGATGGCAGGGCAGTGGCG, which resulted in a 268 bp deletion beginning at Chromosome 15 position 25,894,926 bp and ending after 25,895,193 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000649912 (exon 2) and 161 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 90 and early truncation 8 amino acids later. There is a 5 bp (GTATA) insertion at the deletion site. (J:188991)
Basic Information
Insertion, Intragenic deletion
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count