Cers5^em2Btlr

The CRISPR/Cas9 system and sgRNA 5'-TGTTACTAAGGTAAGTGAGC-3' was used to generate the mice. The CRISPR/Cas9 system generated a 20-base pair deletion TCATCCGGCTCACTTACCTT at g.21297_21278 (NC_000081.6). The mutation is predicted to destroy the exon 2 donor splice site, resulting in the use of an adjacent cryptic site. The resulting transcript would have a 47-bp insertion causing a frame-shifted protein product beginning after amino acid 100 of the protein and premature termination after the inclusion of seven aberrant amino acids. (J:274568)