Ppox^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAGCTGCTGGACGGACGAG and AGTGAAGCACTGTCGCCACA, which resulted in a 3290 bp deletion beginning at Chromosome 1 position 171,277,260 bp and ending after 171,280,549 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001209397 - ENSMUSE00001248877 (exons 3-12) and 2086 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 29 and early truncation 6 amino acids later. (J:188991)