Tomm70a^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTATTGCCTAGTGTTCGGGA and AGAGAACAAAGTCTCAACCG, which resulted in a 496 bp deletion beginning at Chromosome 16 position 57,134,423 bp and ending after 57,134,918 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000130105 (exon 3) and 369 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 169 and early truncation 7 amino acids later. (J:188991)