Plb1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCTTGCTCACTTTATGCCG and GGCATGCTACGGAGACATAA, which resulted in an 860 bp deletion beginning at Chromosome 5 position 32,269,682 bp and ending after 32,270,541 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001292559 and ENSMUSE00001254053 (exons 5 and 6) and 809 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 85 and early truncation 13 amino acids later. (J:188991)