This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAGCATGCCTAACTCCAAG and AGGAAGCAGCTTAAGTCACG, which resulted in a 337 bp deletion beginning at Chromosome 12 position 87,224,804 bp and ending after 87,225,140 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000114055 (exon 5) and 156 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid 119. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count