This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGGGCTCATTTCAACCTAA and CCTTGACGTTGGAAAGCCAA, which resulted in a 417 bp deletion beginning at Chromosome 18 position 63,030,224 bp and ending after 63,030,640 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001304790 (exon 42) and 164 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 2106 and early truncation 15 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count