Rab3gap1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GACTTATCACAGTGGCTATT and TAGTACTGCATCTGAAGAAG, which resulted in a 500 bp deletion beginning at Chromosome 1 position 127,888,975 bp and ending after 127,889,474 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001274408 (exon 4) and 367 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 12 amino acids later. (J:188991)