This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGTTCGTTTACAAAGTGCC and GCTGAATTAACCACGCACCA, which resulted in a 369 bp deletion beginning at Chromosome 5 position 65,375,614 bp and ending after 65,375,982 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000186798 (exon 3) and 100 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 444 and early truncation 50 amino acids later. (J:188991)