This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCCACCTCTAAGGACAAAC and GTAATTTGAGACTCACAGAG, which resulted in a 404 bp deletion beginning at Chromosome 6 position 47,826,784 bp and ending after 47,827,187 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001268428 (exon 2) and 277 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 8 amino acids later. There is a single bp (A) insertion at the deletion site. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count