Exoc3l4^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGAGTTGTTAGGACCCAGG and AAGAGTCTAGATCACTCCAC, which resulted in a 592 bp deletion beginning at Chromosome 12 position 111,425,123 bp and ending after 111,425,714 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000116352 and ENSMUSE00000116361 (exons 5 and 6) and 357 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 352 and early truncation 1 amino acid later. (J:188991)