Wdr73^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCATCCATAGTGTAGCAGAC and AGAAGTTCAGGTTTTAGTCG, which resulted in a 482 bp deletion beginning at Chromosome 7 position 80,897,760 bp and ending after 80,898,241 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001266575 (exon 5) and 417 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 96 and early truncation 2 amino acids later. (J:188991)