This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACCGACTATAAAAATAAG and TTTGGCTCAGTTGGGTCCTA, which resulted in a 519 bp deletion beginning at Chromosome 2 position 125,665,878 bp and ending after 125,666,396 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000325150 (exon 6) and 467 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 298 and early truncation 15 amino acids later. (J:188991)