Ergic1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAGCAGCCCGCTTCTACAG and GCTGGAGTGGAAATTACCAA, which resulted in a 365 bp deletion beginning at Chromosome 17 position 26,629,494 bp and ending after 26,629,858 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001241041 (exon 5) and 240 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 83 and early truncation 26 amino acids later.