Rab31^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTGGCTTTCTAGGGACAAAA and GGAGTTTCGATGATGCAGAA, which resulted in a 142 bp deletion beginning at Chromosome 17 position 65,717,444 bp and ending after 65,717,585 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000657070 (exon 3) and 60 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 29 amino acids later. There is a 5 bp insertion (TAAAG) at the deletion site. (J:188991)