Sec61a2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGCTTTGTGGTTTTATAT and AAACACTTAGTGGAACACAA, which resulted in a 216 bp deletion beginning at Chromosome 2 position 5,886,393 bp and ending after 5,886,608 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000570184 (exon 4) and 137 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 47 and early truncation 2 amino acids later. (J:188991)