Hsf5^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAATAAACGTACAAGATCT and AGTAGAAGCCAAAGATAGCT, which resulted in a 401 bp deletion beginning at Chromosome 11 position 87,631,359 bp and ending after 87,631,359 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000586323 (exon 3) and 303 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 336 and early truncation 10 amino acids later. (J:188991)