This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGTCTGTAAATCAAAGCCC and GTTTTCTTCACAAGACTGGG, which resulted in a 2580 bp deletion beginning at Chromosome 11 position 20,238,200 bp and ending after 20,240,779 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000333483 and ENSMUSE00000370638 (exons 3 and 4) and 954 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 104, the loss of 542 amino acids but remains in frame for the final 87 amino acids. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count