This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCGACCTCCAGGAACCACC and GAAGGGACTATTAACACCAT, which resulted in a 2793 bp deletion beginning at Chromosome 3 position 89,246,442 bp and ending after 89,249,234 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001309950 and ENSMUSE00000310326 (exon 2 and 4) and 2507 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 43 amino acids later. There is a 30 bp insertion at the deletion site (TAATAGTCCCTTCCCTTCCCACCATATGCC) (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count