Ntmt2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCTCCAGCTCTATCCCTAG and TTTGTTGTACACGTGTTTAT, which resulted in a 596 bp deletion beginning at Chromosome 1 position 163,703,825 bp and ending after 163,704,420 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000853217 (exon 3) and 250 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 111 and early truncation 1 amino acid later. (J:188991)