This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCAAACTCATCAAATTCCG and GTTGTACTCTTAATGTAGGT, which resulted in a 1259 bp deletion beginning at Chromosome 1 position 58,492,609 bp. There is a 6 bp endogenous retention (CTACAT) after 58,493,784 followed by 74 bp of the deletion and ending after 58,493,873 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000155147 and ENSMUSE00000238668 (exons 6 and 7) and 1137 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 109 and early truncation 2 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count